Input and Output

This vignette covers how data gets into Dowser and the different ways Dowser objects and trees can be saved. These formats primarily follow the Adaptive Immune Receptor Repertoire (AIRR) Community standard formats. Specifically this will cover AIRR TSV input, as well as AIRR Trees and Clones JSON format (writeTreesJSON/readTreesJSON), plain R serialization (saveRDS/readRDS), Newick tree export (exportTrees), and FASTA sequence export/import (writeFasta/readFasta).

Reading AIRR Rearrangement sequencing data files

The best input format for Dowser is the AIRR Rearrangement TSV format. The airr package’s read_rearrangement function reads such a file into a data frame:

library(airr)
library(dowser)

# Read in an AIRR-formatted TSV file of Ig/TCR rearrangements
airr_data <- read_rearrangement("sequences.tsv")

To keep this vignette self-contained, we’ll instead use the ExampleAirr data object included with Dowser, which is the kind of data frame read_rearrangement would return.

library(airr)
library(dowser)

# load example AIRR data, as if read in with read_rearrangement
data(ExampleAirr)

# subset data for this example
ExampleAirr <- ExampleAirr[ExampleAirr$clone_id %in% c("3170", "3184"),]

From here, formatClones groups sequences into clones and reconstructs germlines, and getTrees builds a lineage tree for each clone (see the Build Lineage Trees vignette for details on both steps).

Before this step, it’s important that the BCR sequences are already grouped into clones beforehand (they will have a clone_id column). This can be accomplished using SCOPer. Further, it is imporant that each clonal germline V/J has has been reconstructed, which can be accomplished using (createGermlines)[https://dowser.readthedocs.io/en/stable/vignettes/Germlines-Vignette/]. This will generate a germline_alignment_d_mask column. To see all of these steps together, check out one of the full Immcantation tutorials.

# Process example data into proper format, store isotype (optional)
clones <- formatClones(ExampleAirr, traits="c_call")

# Build maximum parsimony trees for each clone
trees <- getTrees(clones, nproc=1)

print(trees)
## # A tibble: 2 × 5
##   clone_id data       locus  seqs trees  
##      <dbl> <list>     <chr> <int> <list> 
## 1     3170 <airrClon> N        13 <phylo>
## 2     3184 <airrClon> N        12 <phylo>

trees is a standard Dowser object: a tibble with one row per clone with an airrClone object in the data column and a tree (ape::phylo, or treeio::treedata for time trees) in the trees column. The rest of this vignette covers ways to save and reload this object.

scRepertoire and Dowser compatability

While Dowser was designed to work downstream of Immcantation packages, it is possible to use Dowser and other Immcantation packages in combination with scRepertoire.

To learn how to do this, check out the scRepertoire team’s excellent tutorial about Combining Immcantation and scRepertoire.

Saving and loading Dowser objects in AIRR Clone JSON format

To save an entire Dowser object, including trees, use writeTreesJSON to write a Dowser object to an AIRR Clone JSON file. Conversely, readTreesJSON reads it back. This works for trees built with any getTrees build option, as well as time trees from getTimeTrees/ getTimeTreesIterate. By default, writeTreesJSON reloads the file it just wrote and checks that it matches the original object before returning.

# Write tree object to a JSON file, checking it reads back identically
writeTreesJSON(trees, "trees.json")
## [1] "Note: internal node numbers/labels not currently preserved."
## [1] "Loading object to check consistency"
## [1] "Objects equivalent: 2328 tree checks, 0 failures"
# Read it back in
trees_json <- readTreesJSON("trees.json")

print(trees_json)
## # A tibble: 2 × 5
##   clone_id data       locus  seqs trees  
##      <int> <list>     <chr> <int> <list> 
## 1     3170 <airrClon> N        13 <phylo>
## 2     3184 <airrClon> N        12 <phylo>

Because it’s plain JSON with a documented schema, this format is useful for archiving trees long-term, sharing them with collaborators who aren’t using R, or loading them into other tools.

Note that internal node labels are not preserved when inputting/outputting in this schema, but this is only relevant if you’re manually selecting particular nodes, such as reconstructing internal node sequences. All other aspects of the Dowser object are preserved and checked on output.

Saving and loading Dowser objects as RDS

If you’re staying within R, saveRDS/readRDS is the simplest way to save a Dowser object exactly as-is, with no format translation, although it is a binary file that is unreadable outside of R.

# Save tree object to an RDS file
saveRDS(trees, "trees.rds")

# Read it back in
trees_rds <- readRDS("trees.rds")

print(trees_rds)
## # A tibble: 2 × 5
##   clone_id data       locus  seqs trees  
##      <dbl> <list>     <chr> <int> <list> 
## 1     3170 <airrClon> N        13 <phylo>
## 2     3184 <airrClon> N        12 <phylo>

Exporting trees in Newick format

exportTrees writes the trees in a Dowser object in order to a single Newick file, one tree per line, using ape::write.tree.

Alternatively, the list of tree objects in the trees column can be exported using many other output functions, for example ape::write.tree.

# Export trees to a Newick file
exportTrees(trees, "trees.newick")

# write a single tree
ape::write.tree(trees$trees[[1]], "clone1.tree")

Exporting and reading sequences as FASTA

writeFasta writes a named list of sequences to a FASTA file, and readFasta reads a FASTA file back into a named list. These are generic sequence I/O functions and provided for convenience.

# Get sequences and sequence IDs for the first clone
seqs <- clones$data[[1]]@data$sequence
names(seqs) <- clones$data[[1]]@data$sequence_id

# Write them to a FASTA file
writeFasta(seqs, "clone_3170.fasta")

# Read them back in
seqs_read <- readFasta("clone_3170.fasta")

print(names(seqs_read))
##  [1] "GN5SHBT05JRVYI" "GN5SHBT03CD0X0" "GN5SHBT01CYOTL" "GN5SHBT08H09N9"
##  [5] "GN5SHBT05JBJ6C" "GN5SHBT07H3PB9" "GN5SHBT02D1O6O" "GN5SHBT06IQR02"
##  [9] "GN5SHBT08JDD2A" "GN5SHBT01C1K1O" "GN5SHBT03D53SO" "GN5SHBT06HRA91"
## [13] "GN5SHBT04BVB8W"

Alternatively, dfToFasta writes sequences straight from a data frame or tibble to a FASTA file, without needing to build a named list first. By default it reads sequence IDs and sequences from the sequence_id/sequence columns, strips IMGT gap characters (.), and can append extra columns to each sequence’s header.

# Get the data frame of sequences for the first clone
df <- clones$data[[1]]@data

# Write to FASTA, tagging each header with its isotype
dfToFasta(df, "clone_3170_df.fasta", columns="c_call")

cat(readLines("clone_3170_df.fasta")[1:2], sep="\n")
## >GN5SHBT05JRVYI|c_call=IGHG4
## GAGGTGCGGCTGGTGGAGTCTGGGGGAGGCTTGATACAGCCAGGGCGGTCCCTCAGACTCTCCTGTACAGCTTCCGGGTTCAACTTTGCTGGTTATGCTGTGACCTGGTTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGATAGGTTTCATTAGAAGCAAAACTTTCGGTGGGACAGCAGAGTTCGCCGCGTCTGTGAAGGGCAGATTCACCATCTCAAGAGATGATTTCAGAAGCATCGCCTATCTGCAAATGAATGACCTGAAAAGCGAAGACACAGCCGTATATTTCTGTAGTAGAGATCTCGCGGTTAGTTCCACAGTTGCTGGGACTAATTGGTTCGACCCCCGGGGCCAGGGAACCCGGGTCATTGTGTCCTCAGNN

Use id/seq to point at differently-named columns, and imgt_gaps=TRUE to keep IMGT gaps rather than stripping them.

Making and saving tree plots

Now that trees are built and saved, see the Plotting Trees vignette for how to visualize trees and save tree plots as files.